Site FMPMC
     Page précédentePage suivanteSommaireVersion imprimable
   
 

Biologie Moléculaire

Plan du cours

Objectifs PAES commun DHU Paris-Est

I - La structure des acides nucléiques

1 - Molécules simples

2 - Les acides nucléiques

II - Biosynthèse des macromolécules

3 - DNA Définitions

4 - La transcription

5 - La traduction

6 - La réplication

7 - La réparation

III - Les événements génétiques

8 - Substitutions

9 - Mutations

10 - Insertions - délétions

11 - Transpositions

IV - L’évolution

12 - Divergence

13 - Familles de gènes

V - Le DNA au laboratoire

14 - Méthodes d’étude


Tous droits de reproduction réservés aux auteurs


traduction HTML V2.8
V. Morice


Partie III - Les événements génétiques
Chapitre 11 - Transpositions

 

11.2 - Séquence Alu

 

Image BM_72_PICT.jpg
BM 72

  • A peu de distance en aval du gène de l’apoA-II, on rencontre une séquence transposée de la famille Alu.
  • C’est un pseudogène, entouré de deux séquences répétées (GAAAATGAGGGTACCCT) qui sont caractéristiques des séquences transposées. Entre ces deux séquences on trouve deux séquences homologues séparées par une courte séquence de liaison (TACTAAAAATACAAAAATTA). Plusieurs sites caractérisent encore cette séquence Alu : site d’initiation de la RNA-polymérase III, site de restriction de l’enzyme Alu I (d’où le nom de séquence Alu), queue poly-A. La séquence Alu résulte d’une transposition de la séquence du RNA 7 S, RNA de structure de la SRP (Signal Recognition Particle).
  • Il y a près d’un million de séquences Alu de ce type dans le DNA humain, soit une tous les 4 kb. Il en est de même chez la plupart des Primates et des Rongeurs. D’autres séquences transposées sont connues chez l’Homme ou d’autres Mammifères.

     Page précédentePage suivanteSommaireVersion imprimable
   
 
11.1 - Transposition
11.2 - Séquence Alu
11.3 - Virus
11.4 - Cycle d’un rétrovirus
11.5 - Duplication de gène
11.6 - Pseudogène
11.7 - Conversion de gène